NUR 2497 PHARMACHOLOGY EXAM 1, EXAM 2, EXAM 3 AND FINAL EXAM COMPLETE COURSE NEWEST 2024ALL QUESTIONS AND CORRECT ANSWERS (VERIFIED ANSWERS)|ALREADY GRADED A+|| RASMUSSEN COLLEGE

NUR 2497 PHARMACHOLOGY EXAM 1, EXAM
2, EXAM 3 AND FINAL EXAM COMPLETE
COURSE NEWEST 2024ALL QUESTIONS AND
CORRECT ANSWERS (VERIFIED
ANSWERS)|ALREADY GRADED A+||
RASMUSSEN COLLEGE
All the offspring of a cross between a black-eyed Mendelian and an orange-eyed
Mendelian have black eyes. What is the expected phenotypic ratio of a cross between
two orange-eyed Mendelians?
A) 3 black-eyed: 1 orange-eyed
B) 0 black-eyed: 1 orange-eyed
C) 1 black-eyed: 3 orange-eyed
D) 1 black-eyed: 0 orange-eyed - ANSWER-B
normal muscle cell produces the myosin protein, which allows muscles to contract. You
discover a single muscle cell that has tRNA As that do not bind to amino acids. Will the
myosin gene be expressed in this muscle cell? Why or Why not?
A) Yes, because all cells in the body express in the myosin gene all of the time
B) No, because if the tRNAs do not bind to amino acids, then translation cannot occur
C) Yes, because the myosin gene will be transcribed in the muscle cell nucleus
D) No, because the myosin mRNA will likely get broken down into cytoplasm -
ANSWER-B
A stomach cell is producing pepsin, an enzyme that hydrolyzes proteins. Which of the
following events suggests that gene expression of pepsin has been turned off in the
cell?
A) The pepsin protein is folded properly in the cytoplasm
B) The chromosome with the pepsin gene is tightly coiled
C) The pepsin mRNA leaves the nucleus and enters the cytoplasm
D) Activators and RNA polymerase are abundant in the nucleus - ANSWER-B
There is a mutation in the operator of the lac operon in a cell such that the lac repressor
always stays bound to the operator. If lactose is added to the cell, what will happen?
A) Lactose will bind to the repressor, and lac enzymes will be produced
B) Lactose will bind to the repressor, and lac enzymes will not be produced
C) Lactose will not bind to the repressor, and lac enzymes will be produced
D) Lactose will bind to the operator, and lac enzymes will be produced - ANSWER-B
During an experiment assessing the development of a fly embryo, a scientist artificially
turns on a homeotic gene that controls eye development in somatic cells that normally
develop into the wings. Which of the following is the most likely outcome of this
experiment?
A) A normal adult fly will develop
B) A mutant adult fly will develop that has eyes on its wings
C) a mutant adult fly will develop that has legs on its head
D) A mutant adult fly will develop that has no eyes on its head but has eyes on its wing -
ANSWER-B
What is the correct order of structures in a chromosome from smallest to largest?
A) Nucleotide, Nucleosome, Histone, Tight Helical Fiber, Chromosome
B) Nucleosome, Nucleotide, Histone, Tight Helical Fiber, Chromosome
C) Nucleotide, Histone, Tight Helical Fiber, Nucleosome, Chromosome
D) Nucleotide, Histone, Nucleosome, Tight Helical Fiber, Chromosome - ANSWER-D
There is a mutation in the operator of the trp operon in a cell such that the trp repressor
is unable to bind to the operator. If tryptophan is added to the cell, what will happen?
A) Tryptophan will bind to the repressor, and trp enzymes will be produced
B) Tryptophan will bind to the repressor, and trp enzymes will not be produced
C) Tryptophan will not bind to the repressor, and trp enzymes will be produced
D) Tryptophan will bind to the operator, and trp enzymes will be produced - ANSWER-A
Researchers wish to use RNAi to prevent the expression of the enzyme hexokinase in
order to study its impact on glycolysis. Which of the following processes would still
occur if the researchers used RNAi effectively to silence hexokinase expression?
A) folding of the hexokinase
B) translation of the hexokinase
C) transcription of the hexokinase gene - ANSWER-C
(Look at the Drawing of the lac operon #25 on Chapter 11 Quiz) Which Molecule is an
inactive repressor?
A) Molecule A
B) Molecule B
C) Molecule C
D) Molecule D - ANSWER-D
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret
(^) indicates the cut site. Examine the DNA molecule below.
AGAGCTCAGTCGAGAGCTCAGATCGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG
How many separate molecules of DNA would you end up with if you treated the above
DNA molecule with SacI?
A) two
B) three
C) four
D) five - ANSWER-C
Researchers are trying to make a genetically modified (GM) pig that expresses bovine
(Cow) growth hormone to make it grow bigger. They isolated the bovine growth
hormone gene, cut it and a plasmid with the same restriction enzyme, and mixed them
together. They inserted the mixture into pig zygotes, but only normal pigs, not GM pigs,
grew. What did they likely do wrong?
A) They are trying to make a GM animal, which is impossible
B) They forgot to add DNA ligase after mixing the plasmid and gene together
C) They should have used different restriction enzymes to cut the plasmid and the gene
D) They forgot to use PCR and make multiple copies of the growth hormone gene -
ANSWER-B
Which is a genetically modified organism but not a transgenic organism?
A) Flavr Savr Peaches ( peaches that express larger quantities of a peach stability
enzyme)
B) Golden Rice ( rice that expresses daffodil and bacteria beta-carotene synthesis
enzymes)
C) AquAdvantage salmon ( Atlantic salmon that expresses Chinook salmon growth
hormone)
D) Roundup Ready soybeans ( soybeans that express bacterial pesticide enzymes) -
ANSWER-A
You are setting up a PCR reaction and add a primer for one end of the target sequence,
but you forget to add the primer for the other end of the target sequence. If you added
the other necessary components, what do you expect to observe after running the PCR
reaction for 40 cycles?
A) The PCR reaction will produce billions of copies of the target DNA
B) The PCR reaction will produce millions of copies of the target DNA
C) The PCR reaction will produce one copy of the target DNA
D) The PCR reaction will produce zero copies of the target DNA - ANSWER-D
Biotechnology companies sell kits that allow you to do PCR to amplify STR regions from
human blood samples that you have collected. What components would you expect to
find in the kit in order to be able to do successful PCR reactions?
A) human DNA polymerase, primers that flank STR regions only
B) heat-stable DNA polymerase, primers that flank STR regions only
C) human DNA polymerase, primers that flank STR regions, free nucleotides
D) heat-stable DNA polymerase, primers that flank STR regions, free nucleotides -
ANSWER-D
TPOX is one of the STRs that is used to compare DNA between different people. Why
is TPOX useful for comparing DNA between different people?
A) TPOX varies in the number of repeats between different people
B) TPOX varies in sequence between different people
C) TPOX is only present in some people's genomes
D) TPOX is present in different places in different people's genomes - ANSWER-A
Cystic Fibrosis is a genetic disease that results from a defective CFTR protein that
alters ion flow through the cell membrane such that water does not cross the cell
membrane. Gene Therapy is being used to attempt to help cystic fibrosis patients.
Which of the following steps is NOT needed to develop a gene therapy treatment for
cystic fibrosis?
A) Clone the normal-functioning CFTR gene and make a RNA version of the gene
B) Make antibodies to the defective CFTR protein to enhance the patient's immune
system
C) Remove cells from a patient and infect them with the recombinant virus
D) Insert the RNA version of the CFTR gene into a virus - ANSWER-B
Which is a transgenic organism?
A) a fern grown from a single fern root cell
B) a rat that has had rabbit hemoglobin genes added to its genome
C) a cow that has been fed pig growth hormone in its food
D) a human given a corrected human blood-clotting gene - ANSWER-B
You are trying to produce cDNA starting from mRNA in skeletal muscle cells. You add
the following components to a tube and let the reaction proceed: skeletal muscle
mRNA, free nucleotides, and DNA polymerase. After inspecting the products of the
reactions, you do not find an cDNA molecules at all. What is the most likely explanation
for this result?
A) You used mRNA instead of genomic DNA as the source material
B) You used DNA polymerase instead of reverse transcriptase
C) cDNA can only be made from skin cell mRNA molecules
D) You forgot to add a radio-labeled nucleic acid probe to the tube - ANSWER-B
Gel electrophoresis is normally set up with the negative electrode at the top of the gel
and the positive electrode at the bottom of the gel. The DNA products are loaded at the
top of the gel, and then a current is applied to separate them. However, when preparing
to run a gel, you accidentally switched the locations of the negative and positive
electrodes such that the positive electrode is at the top and the negative electrode is at
the bottom. You still loaded the DNA products at the top of the gel as normal. What
results are you most likely to observe if you apply an electric current to this gel setup?
A) All DNA molecules will migrate toward the positive electrode
B) All DNA molecules will migrate toward negative electrode
C) Shorter DNA molecules will move toward the positive electrode, and longer DNA
molecules will move toward negative electrode
D) Longer DNA molecules will move toward the positive electrode, - ANSWER-A
Suppose a researcher is interested in using the CRISPR-Cas9 system to knock out the
phosphofructokinase gene of a rat skin cell that codes for an enzyme that is critical for
glycolysis to occur. The researcher added Cas9 enzyme to the cell but forgot to add the
guide RNA. What results do you think the researcher will observe?
A) Glycolysis will proceed normally in the cell
B) The phosphofructokinase enzyme will be expressed but will have lower activity.
C) Cas9 will specifically cut the phosphofructokinase gene
D) There will be mutations in the phosphofructokinase gene - ANSWER-A
(Use the Picture On Chapter 12 test #25) The Bands in the ladder are in 10-base
increments, starting with 10 bases at the bottom and going to 70 bases at the top. CS,
Crime Scene; S1, suspect 1; S2, suspect 2; S3. Which suspect is likely yo have
committed the crime?
A) Suspect 1
B) Suspect 2
C) Suspect 3 - ANSWER-C
Which of the following statements would Darwin have disagreed with?
A) Species change over time
B) Living species have arisen from earlier life-forms
C) Descent with modifications occurs through inheritance of acquired charcateristics
D) Descent with modifications occurs by natural selection - ANSWER-C
During 1950s, a scientist named Lysenko tried to solve the food shortages in the Soviet
Union by breeding wheat that could grow in Siberia. He theorized that if individual wheat
plants were exposed to cold, they would develop additional cold tolerance and pass it to
their offspring. Based on the ideas of artificial and natural selection, do you think this
project worked as planned?
A) Yes, the wheat probably evolved better cold tolerance over time through inheritance
of characteristics the individuals gained during their lifetime
B) No, because Lysenko took his wheat seeds straight to Siberia instead of exposing
them incrementally to cold
C) No, because there was no process of selection based on inherited traits. Lysenko
assumed that exposure could induce a plant to develop additional cold tolerance and
that this tolerance would be passed to the plant's offspring
D) Yes, because this is generally the method used by p - ANSWER-C
A dog breed wishes to develop a breed that does not bark. She starts with a diverse
mixture of dogs. Generation after generation, she allows only the quietest dogs to
breed. After 30 years of work she has a new breed of dog with interesting traits, but on
average, the dogs still bark at about the same rate as other dog breeds. Which of the
following would be a logical explanation for her failure?
A) There is great deal of variation for the trait (Barking)
B) The tendency to bark is not a heritable trait
C) The selection was artificial, not natural, so it did not produce evolutionary change
D) Quiet dogs have fewer pups than barkers - ANSWER-B
Humans share several features with salamanders. Certain genes and proteins are
nearly identical between the two species; both species have four limbs with a similar
skeletal structure; the species' early embryos are very similar; and where the
salamander has a functional tail, humans have